The nucleic acid data:
IRESite Id: 110 Version: 14
Originaly submitted by: Martin Mokrejš Submission date: 2006-01-12 00:00:00
Reviewed by: Martin Mokrejš Last change: 2015-04-08 23:31:45
IRESite record type:
The shape of the nucleic acid molecule translated:
The quality of the mRNA/+RNA sequence:
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
The genetic origin of this natural mRNA/+RNA:
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
The mRNA/+RNA description: 
Homo sapiens apoptotic protease activating factor 1 (Apaf-1) mRNA, complete cds. Similar to C. elegans cell
death gene ced-4.
The mRNA/+RNA sequence represented in the +DNA notation:

Credibility of mRNA sequence:
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
The total number of notable open-reading frames (ORFs):
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
Integrity (uniformity) of mRNA tested using RNase protection:
Integrity (uniformity) of mRNA tested using 5'-RACE:
Integrity (uniformity) of mRNA tested using primer extension :
Integrity (uniformity) of mRNA tested using RT-PCR:
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
Integrity (uniformity) of mRNA tested using RNAi:
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
The organism used:
Homo sapiens HeLa (ATCC CCL-2)
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF position:   1
Version: 3 Last change: 2009-09-01 19:57:05
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
The description of the protein encoded in this ORF:
apoptotic protease activating factor 1
The translational frameshift (ribosome slippage) involved:
The ribosome read-through involved:
The alternative forms of this protein occur by the alternative initiation of translation:
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
The best really existing mRNA sequence in Genbank is AK307509 (GI:164692476) which has longer 5'-UTR by 159bp
(obtained by oligo-capping approach) compared to entry AF013263 (GI:2330014). The below mentioned 7kb long
sequence is a chimera of Apaf1 mRNA with another gene since position 5244:

>emb|CR603841.1| UniGene info full-length cDNA clone CS0DI077YE15 of Placenta Cot 25-normalized of Homo
sapiens Length=1596




AF013263  6444  AGG  6446
Sbjct     1200  AGG  1202




AF013263  6977  gaatttaaaaaatttttgtaaaaataaaattcacaaaa  7014

The Apaf1-mRNA region in this chimeric message of AF013263 ends at the position 4283:

>gb|EF560718.1| UniGene infoGene info Homo sapiens clone DKFZp781B1145 APAF1 protein (APAF1) mRNA, complete
cds Length=3744




Interestingly, several mRNAS incomplete at the 3'-end terminate just at position 4162 which is a STOP codon:

>emb|AJ243004.1| UniGene infoGene info Homo sapiens mRNA for apoptotic protease activating factor 1



In conclusion, we have used sequence in AK307509 for the 5'-UTR and most of the CDS and the record EF560718
to get up to the 3'-end.

Several alternatively spliced messages exist but the splice junctions are in the CDS, thus not important to
the IRES story.

Integrity of the transcripts was verified by Northern blot using randomly primed cDNA probes against Fluc.
Shorter transcript fragment of 1.3kb was detected (also found in pRmycF transcripts containing c-myc). No more
sensitive testing of integrity of transcripts produced was done, e.g. RT-PCR of the in vivo produced
transcription products or direct mRNA transfection or tests based on a promoter-less plasmid. [Coldwell et
al., 2000]

It appears the very two 3'-most bases of the 5'-UTR of Apaf-1 were not cloned into the pRAF plasmid vector
because they had to be replaced by 'cc' bases of the cloning NcoI site 'ccATGg'. Please refer to the
annotation of pRAF plasmid (IRESiteID:341).

Cammas et al. (2007) confirmed either a splicing or cryptic promoter issue with the pRAF plasmid in DNA
transfections (Supplemental Figure S2) in RNAi based assay in which they were not able to inhibit the Apaf-1
IRES activity like of EMCV, HRV IRES. They repeated results of Sherril et al. (2004) showing that either a
splicing issue or a promoter is functional in HeLa cells when Bcl2 IRES is placed into the pRF vector.
Further, they show that in direct mRNA transfection Apaf-1 IRES activity is only 2x above the empty vector
control (capped, poly(A)-tailed messages) and thus conclude as not functional.
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
Cammas A., Pileur F., Bonnal S., Lewis S. M., Leveque N., Holcik M., Vagner S. (2007) Cytoplasmic relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation initiation of specific mRNAs. Mol. Biol. Cell. 18(12):5048-5059
Version: 7 Last change: 2009-09-01 19:57:05
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
The IRES absolute position (the range includes START and STOP codons or their equivalents):
How IRES boundaries were determined:
The sequence of IRES region aligned to its secondary structure (if available):

The -233 to -1 (due to the cloning approach possibly only -233 to -3) fragment retains 75% activity (Fig. 6B)
of the full-length 5'-UTR (1-577b). Apaf-1 IRES is functional in HeLa, HepG2 cells, lower activity was seen in
MCF7, HK293, COS7, MRC5 cells. No activity seen in SY5Y and Balb/c cells.
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
RNA:protein interactions:
The RNA:protein interaction:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The description of the protein interacting with the RNA:
Heterogeneous nuclear ribonucleoprotein (hnRNP) A1
The organism where this RNA:protein interaction occurs:
Homo sapiens HeLa (ATCC CCL-2)
The interaction was confirmed by several methods using HeLa cell nuclear extracts (NE) with 32P-labeled RNAs.
Data in Figure 1.
Cammas A., Pileur F., Bonnal S., Lewis S. M., Leveque N., Holcik M., Vagner S. (2007) Cytoplasmic relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation initiation of specific mRNAs. Mol. Biol. Cell. 18(12):5048-5059
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 26
Version: 1 Last change: 2009-09-01 19:57:05
Originaly submitted by: Václav Vopálenský Reviewed by: Václav Vopálenský
The function of the 2D structure:
The 2D structure causes frameshift:
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
The underlying nucleic acid sequence and structure of the mapped region:

Structure from Fig. 4E.
4.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 48
The temperature (in degrees of Celsia):
The enzymatic method used to determine the 2D structure:
ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
Li+ [mM]
Na+ [mM]
K+ [mM]
Mg2+ [mM]
Ca2+ [mM]
Cl- [mM]
Tris [mM]
BSA [mM]
cacodylate [mM]
4.1.2. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 20
The temperature (in degrees of Celsia):
The chemical reagent used to determine the 2D structure:
Chemical reagent used with its respective buffer:
Version: 0
Li+ [mM]
Na+ [mM]
K+ [mM]
Mg2+ [mM]
Ca2+ [mM]
Cl- [mM]
Tris [mM]
BSA [mM]
cacodylate [mM]
Other buffer components and their relative concentrations:
20mM acetate (CH3COO)-
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 21
The temperature (in degrees of Celsia):
The chemical reagent used to determine the 2D structure:
Chemical reagent used with its respective buffer:
Version: 0
Li+ [mM]
Na+ [mM]
K+ [mM]
Mg2+ [mM]
Ca2+ [mM]
Cl- [mM]
Tris [mM]
BSA [mM]
cacodylate [mM]
Other buffer components and their relative concentrations:
20mM acetate (CH3COO)-
Mitchell S. A., Spriggs K. A., Coldwell M. J., Jackson R. J., Willis A. E. (2003) The Apaf-1 internal ribosome entry segment attains the correct structural conformation for function via interactions with PTB and unr. Mol. Cell. 11(3):757-771
Last change to the database: 2019-03-18 09:32:49 GMT+1