The nucleic acid data:
IRESite Id: 112 Version: 10
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2007-02-15 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
Putative bicistronic mRNA derived in vitro from T7 promoter. The sequence here spans from the
predicted T7 transcription start to the XhoI site, which is positioned more than 300b after the synthetic
polyA region.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pRL-HCV-FL-polyA
The name of the promoter used to express this mRNA:
  T7
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
HCV_type_1b
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Hepatitis C virus type 1b
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map: pRL-HCV-FL-polyA.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  12-947
ORF
ORF position:   2
Version: 3 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc-fusion
The description of the protein encoded in this ORF:
Firefly luciferase fused with 22 additional aminoacid residues (including the initiator ATG) from HCV polyprotein at its N-terminus (ATGAGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCGGCCCACAGGACGTC). Please note the point mutation from CCGCCG to CCGCGG to introduce the SacII site.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1367-3085
Remarks:
The donor vector of HCV IRES from S. Lemon / K. Honda (pRL-HL) contained 341 nt of HCV IRES (5'-UTR region
only) and 66 nt of the coding protein sequence (including the initiator ATG). This plasmid was point mutated
to contain SacII restriction site 19-14nt in front of the FLuc ORF (CCGCCG to CCGCGG).

Integrity of RNA 8 hrs after the direct RNA transfection was confirmed in work of van Eden et al.
(2004) and shown in Fig. 5D.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Translation of cellular inhibitor of apoptosis protein 1 (c-IAP1) mRNA is IRES mediated and regulated during cell stress. RNA. 10(3):469-481
IRESs:
IRES:
Version: 6 Last change: 2006-10-30 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  HCV_type_1b
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1026-1366
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  79
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  419
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -341
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
As the IRES region we have annotated solely the 341 nts of HCV 5'-UTR. Thus, the 66 nt spacer between the
3'-end of IRES and the FLuc ORF is not annotated as IRES. Please note this region is translated and therefore
these 22 aminoacid residues encoded here are fused to the N-terminus of the FLuc protein. Despite the short
polyA tail the capped RNAs were found to be stable. The article does not discuss the more than 300 bases
spanning up to the XhoI site after the internal poly(A) tract.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
The translation experiments:
Translation results:
IRESite Translation Id: 91
Version: 8 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vitro
The in vitro translation system:
rabbit reticulocytes lysate
The organism used for translation:
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL-polyA
IRESite Id of the plasmid used as negative control.
  133
The relative translation efficiency in % of the negative control:
  0
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_with_GpppG_cap_with_polyA_tail
Remarks:
These data are based on Fig. 2 in the article. In vitro transcripts were produced using T7 polymerase in
presence of m7G cap analog at ratio of 4:1 versus rGTP and equimolar amounts of RNA were subject to
translation in RRL. RNAs had short (35nt) long polyA tail. pRL-FL was used as the negative control although
pRL-revH-FL would have been better. The actual expression from the second cistron was 4.5% of the first
cistron. The yields from the first cistron were not equal although all transcripts were capped and 5'-UTRs had
same length. One of the possible explanations might be that different efficiencies of capping account for
this.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
Translation results:
IRESite Translation Id: 323
Version: 4 Last change: 2007-07-16 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HEK 293T/17 (ATCC CRL-11268)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL-polyA
IRESite Id of the plasmid used as negative control.
  133
The relative translation efficiency in % of the negative control:
  0.230
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_without_cap_with_polyA_tail
Remarks:
HCV IRES does not require ITAFs to be functional in rabbit reticulocyte lysates and in direct RNA transfection
assays. Experiments with bot capped and uncapped messages confirm HCV IRES is functional even without
ribosomes being loaded on mRNA via the 5'-cap (FLuc activity drops to 58% when uncapped mRNA is used instead
of capped). Needless to say, efficiency of in vitro capping is not fully efficient so the percentages
appear higher.
Citations:
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA. 10(4):720-730
Translation results:
IRESite Translation Id: 324
Version: 3 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HEK 293T/17 (ATCC CRL-11268)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL-polyA
IRESite Id of the plasmid used as negative control.
  133
The relative translation efficiency in % of the negative control:
  7.100
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_with_GpppG_cap_with_polyA_tail
Remarks:
The "IRES" activity of the negative is the cap-dependent ribosome reinitiation of the pRL-FL plasmid. The FLuc
activity is 12x lower when uncapped RNAs are transfected into the cells whereas RLuc activity is 4x lower.
Citations:
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA. 10(4):720-730
Last change to the database: 2011-04-08 22:43:22 GMT+1