A promoter reported in cDNA corresponding to IRES sequence: no
The total number of notable open-reading frames (ORFs): 1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using RNase protection: not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE: not_tested
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: not_tested
Integrity (uniformity) of mRNA tested using RNase protection: not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE: not_tested
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
The abbreviated name of this ORF/gene: polyprotein
The description of the protein encoded in this ORF: genomic polyprotein
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: no
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 834-7712
Remarks:
The initial studies of EMCV IRES were based on the pMPS1-based bicistronic plasmids containing viral sea
oncogene and polioviral 2A gene (Jang et al., 1988).
Almost no luciferase activity could be measured in cells transfected with promoter-less bicistronic
constructs. Further, no shorter luciferase containing transcripts could be detected on Northern-blots. The
sequence of the EMCV-R IRES is available in a GenBank record GI:9626692 (NC_001479 having exactly same
sequence as the original Rueckert strain in M81861 record described by Palmenberg).
At some point EMCV IRES used in labs acquired a point mutation/insertion causing high dependence on PTB
protein (Kaminski and Jackson, 1998). Note the 7 'a' instead of just 6.
mutated: 482 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 541
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
wt: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798
The disctinction between EMCV-R, EMCV-B, EMCV-D and mengovirus-M in their poly(C) tracts is e.g. shown in Duke
et al. (1992), Fig. 2.
Bet et al. (2006) and Young et al. (2008) used EMCV IRES a a positive in their experiments and therefore
tested whether the IRES contains promoter activity in HeLa and NIH3T3 cells, respectively. They did not
confirm one.
The IRES absolute position (the range includes START and STOP codons or their equivalents): 257-832
Conclusion: strongly_supported_IRES
How IRES boundaries were determined: experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
The sequence tested had IRES activity in many in vivo and in vitro experiments including direct
RNA transfections. Efficiency of EMCV IRES-based commercially available vectors was discussed by Bochkov and
Palmenberg, 2006.
At some point EMCV IRES used in labs acquired a point mutation/insertion causing high dependence on PTB
protein (Kaminski and Jackson, 1998). Note the 7 'a' instead of just 6.
mutated: 482 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 541
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
wt: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798
Heterogeneous nuclear ribonucleoprotein (hnRNP) A1 was not found to bind to EMCV IRES (Cammas et al., 2007)
which binds to HRV-2 and Apaf-1 IRESs.
EMCV IRES does not require Unr protein for its activity (Boussadia et al., 2003).
EMCV IRES does not require ITAF45 protein for its activity (Pilipenko et al., 2000).
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 372-808
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of EMCV-R mRNA 437 nt long with energy of -134.91 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
The sequence published in the article probably contains mistyped single base at position 775. It should be 'a'
instead of 'g'. Please note the Remarks above about the PTB dependency (it is just about this strecth of
adenosines).
>IRESite_Id:140 EMCV-R virus
Length = 7835
Score = 757 bits (433), Expect = 0.0
Identities = 436/437 (99%)
Strand = Plus / Plus
Query: 1 agggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 agggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctc 431
Query: 61 gccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 432 gccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttct 491
Query: 121 tgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgac 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 tgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgac 551
Query: 181 aggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 552 aggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccc 611
Query: 241 cagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgta 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 612 cagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgta 671
Query: 301 ttcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctgggg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 672 ttcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctgggg 731
Query: 361 cctcggtgcacatgctttacatgtgtttagtcgaggttaaaaagcgtctaggccccccga 420
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 732 cctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccga 791
Query: 421 accacggggacgtggtt 437
|||||||||||||||||
Sbjct: 792 accacggggacgtggtt 808
4.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 67
The temperature (in degrees of Celsia): 37
The enzymatic method used to determine the 2D structure: ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 0
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 220.00
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
200 mM NH4+
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 68
The temperature (in degrees of Celsia): 37
The enzymatic method used to determine the 2D structure: S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 4.70
Li+ [mM] 0
Na+ [mM] 90.00
K+ [mM] 0
Mg2+ [mM] 5.00
Ca2+ [mM] 0
Cl- [mM] 20.00
Tris [mM] 0
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
2 mM Zn2+
6 mM NH4+
40 mM acetate
4.1.2. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 29
The temperature (in degrees of Celsia): 37
The chemical reagent used to determine the 2D structure: DMS
Chemical reagent used with its respective buffer:
Version: 0
pH 7.00
Li+ [mM] 0
Na+ [mM] 100.00
K+ [mM] 0
Mg2+ [mM] 20.00
Ca2+ [mM] 0
Cl- [mM] 40.00
Tris [mM] 0
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations: