A promoter reported in cDNA corresponding to IRES sequence: yes
The total number of notable open-reading frames (ORFs): 1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using RNase protection: not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE: heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
The abbreviated name of this ORF/gene: Polyprotein
The description of the protein encoded in this ORF: HCV polyprotein
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 342-9377
Remarks:
There is another open-reading frame coding for the F protein. The F protein synthesis is initiated in the +1
reading frame at a non-AUG codon (GUG or GCG) overlapping codon 26 of the polyprotein (Baril et al., 2005).
A cryptic promoter activity of the HCV IRES was recently described (Masek et al., 2007) unlike by others using
insufficient combination of PCR primers (MacCallum et al, 2006).
The IRES absolute position (the range includes START and STOP codons or their equivalents): 1-383
Conclusion: strongly_supported_IRES
How IRES boundaries were determined: experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):
Rendering structure of HCV_type_1a mRNA 383 nt long with energy of -109.14 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
For functionality of IRES is necessary that no strong secondary structures are present immediately downstream
the IRES segment in a synthetic plasmid construct. Same IRES segment is functional in some constructs whereas
it is not in others.
Secondary structure domains II-IV span the IRES. The domain III and IV are the key parts of the IRES and
include a pseudoknot structure. The structural features of many IRESs were summarized in Martinez-Salas et al.
(2001).
A recent survey of several mutations on IRES activity was published by Barrez et al. (2009), Masante et al.
(2008) and Jubin et al. (2000). Analysis of various HCV subtypes was also published (Collier et al., 1998)
Please refer also to sequence 1 from Patent WO0233376.
ITAF fullname: polypyrimidine tract-binding protein isoform 1
ITAF description (long): polypyrimidine tract-binding protein isoform 1 binds dsRNA with (CCU)n motif where n is at least 3. By SELEX
approach it was found it binds to 5'-CAGCCUGGUGCCUCUCUUUCGG-3' (Singh et al. (1995) Science 268:1173-1176)
but also UCUU or UCUUC within pyrimidine-rich sequence (Perez et al. (1997) RNA3:1334-1347).
3.1.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system: no_effect_on_translation
Method used to demonstrate ITAF effect: in_vivo
The organism where action of this ITAF was studied:
Depletion of mRNA for PTB-1 and decrease of protein level to about 10% did not affect activity of HCV IRES.
Data from Figure 3E,F (in vivo). These results contradict those in vitro results from Anwar et al. (2000)
J. Biol. Chem. 275:34231-34235 and from Ali and Siddiqui (1995) J. Virol. 69:6367-6375.
BS-C-1 cells and Huh-7 cells expressing PTB protein from a plasmid displayed increase in HCV IRES activity 5
times (Gosert et al., 2000).
ITAF description (long): La autoantigen (p52), 52 kDa RNA binding protein, predominantly localized to nucleus, unwinds the dsRNA in
ATP-dependent manner, forms a dimer
3.2.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system: required_but_available_internally
Method used to demonstrate ITAF effect: in_vitro
In vitro system used to demonstrate ITAF effect: HeLa cell lysate
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system: required_but_available_internally_although_in_limiting_concentration
Method used to demonstrate ITAF effect: in_vitro
In vitro system used to demonstrate ITAF effect: rabbit reticulocytes lysate
Remarks:
Sequestration of the La autoantigen blocked HCV IRES-mediated translation. It binds to the region close to
initiator AUG codon of HCV core protein encompassed in the HCV IRES, it contains 3 RNA-recognition motifs
(RRM) and the one formed by aminoacid residues 112–184 was shown to have the binding capability (Mondal et
al., 2008).
ITAF description (long): heterogeneous ribonucleoprotein D (AUF1) AU-rich region binding protein
3.3.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system: stimulatory
Method used to demonstrate ITAF effect: in_vivo
The organism where action of this ITAF was studied:
Homo sapiens
Remarks:
Distribution of HCV IRES-containing mRNAs in polysomes isolated from Huh5-15 cells transfected with siRNA
against the hnRNP D changed (Paek et al., 2008). 293T, Huh7
hnRNP D is cofractionated and coimmunoprecipitated with NSAP1, another protein known to modulate HCV IRES
activity.
ITAF description (long): NS1-associated protein 1 (65 and 74 kDa) binding adenosine-rich regions, stimulates HCV IRES activity but not
of EMCV, PV, c-myc
3.4.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system: stimulatory
Method used to demonstrate ITAF effect: in_vivo
The organism where action of this ITAF was studied:
It would be interesting to evaluate whether NSAP1 increased activity of the internal HCV IRES promoter (Figure
3) although it is probably already ruled out by results shown in Figure 5 (Kim et al., 2004).
Abbreviated name of the protein interacting with the RNA: eIF3b
Full name of the protein interacting with the RNA: eukaryotic translation factor eIF3; subunit b
The description of the protein interacting with the RNA: a subunit of translation factor 3 (110/116/120 kDa)
The function of the protein interaction:
Direct interaction between eIF3b and HCV IRES might bypass the function of eIF3j which is involved in a
cap-dependent translation initiation.
The organism where this RNA:protein interaction occurs:
Homo sapiens
Remarks:
Interaction demonstrated by filter-binding-assay and NMR titration of purified protein and radio-labeled
RNA synthesized in vitro.
Regions of interactions reported: 200-206 or 193-200 (Buratti et al., 1998); 120-332 (Perard et al., 2009)
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 1-383
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of HCV_type_1a mRNA 383 nt long with energy of -109.14 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
Preliminary structure was determined by alignment of N2 and Hutchinson HCV strains coupled to GBV-B
primary sequence. In vitro transcripts of HCV region 1-399 were mapped by several ribonucleases. The structure
shown here is from Figure 1 in the article.
5.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 62
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: ribonuclease T1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 63
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: ribonuclease T2
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 64
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 65
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 36-126
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of HCV_type_1a mRNA 91 nt long with energy of -14.20 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
5.2.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 79
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.60
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 0
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 20.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 80
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.60
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 0
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 20.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 1-344
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of HCV_type_1a mRNA 344 nt long with energy of -106.24 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
Data from Figure 3. To align the structure of the AG94 strain over the underlying sequence of this IRESite
record we had to drop an unpaired base corresponding to one of the C bases. Below is an alignment of the AG94
sequence to this IRESite sequence.
>IRESite_Id:222 HCV_type_1a virus
Length = 9416
Score = 591 bits (338), Expect = e-169
Identities = 343/345 (99%), Gaps = 1/345 (0%)
Strand = Plus / Plus
Query: 1 gccagccccctgatgggggcgacactccaccatgaatcactcccctgtgaggaactactg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gccagccccctgatgggggcgacactccaccatgaatcactcccctgtgaggaactactg 60
Query: 61 tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac 120
Query: 121 ccccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgcca 180
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ccc-ccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgcca 179
Query: 181 ggacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgcccc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 ggacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgcccc 239
Query: 241 cgcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatag 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 cgcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatag 299
Query: 301 ggtgcttgcgagtgccccgggaggtctcgtagaccgtgcatcatg 345
|||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 300 ggtgcttgcgagtgccccgggaggtctcgtagaccgtgcaccatg 344
5.3.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 81
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: ribonuclease T1/T2 mix
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 82
The temperature (in degrees of Celsia): 20
The enzymatic method used to determine the 2D structure: S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 50.00
Mg2+ [mM] 10.00
Ca2+ [mM] 0
Cl- [mM] 70.00
Tris [mM] 10.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 40-362
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of HCV_type_1a mRNA 323 nt long with energy of -91.34 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
Data from Figure 1.
5.4.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 83
The temperature (in degrees of Celsia): 37
The enzymatic method used to determine the 2D structure: ribonuclease T1/V1 mix
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 100.00
Mg2+ [mM] 2.50
Ca2+ [mM] 0
Cl- [mM] 100.00
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 44-118
The underlying nucleic acid sequence and structure of the mapped region:
Rendering structure of HCV_type_1a mRNA 75 nt long with energy of -22.10 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.