The nucleic acid data:
IRESite Id: 384 Version: 1
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-06-12 15:25:54
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
104744457 
The mRNA/+RNA description: 
One of the two putative in vivo transcripts of mammalian expression vector pNBio: this one is from minimal CMV
promoter down to beta-globin poly(A) signal from rabbit.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pNBio
The name of the promoter used to express this mRNA:
  CMV
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
EMCV-R
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Encephalomyocarditis virus Rueckert
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pNBio.jpg
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
birA
The description of the protein encoded in this ORF:
biotin ligase, holocarboxylase synthetase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  909-1913
Citations:
Kulman J. D., Satake M., Harris J. E. (2007) A versatile system for site-specific enzymatic biotinylation and regulated expression of proteins in cultured mammalian cells. Protein Expr. Purif. 52(2):320-328
IRESs:
IRES:
Version: 1 Last change: 2011-04-08 22:28:06
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R_260-845
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  282-868
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
There are several differences compared to the reference EMCV-R IRES region sequence:

>IRESite_Id:140 EMCV-R virus
          Length = 7835

 Score =  998 bits (571), Expect = 0.0
 Identities = 583/589 (98%), Gaps = 5/589 (0%)
 Strand = Plus / Plus


Query: 1   cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 319


Query: 61  tgcgtttgtctatatgtgattttccaccatattgccgtcttttggcaatgtgagggcccg 120
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 tgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccg 379


Query: 121 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 439


Query: 181 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 499


Query: 241 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 559


Query: 301 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 619


Query: 361 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaa 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 620 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaa 679


Query: 421 ggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtg 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 680 ggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtg 739


Query: 481 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 540
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798


Query: 541 ggacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 587
           ||||||||||||||||||||||||||||||||||  | | |||||||||
Sbjct: 799 ggacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845
Last change to the database: 2019-03-18 09:32:49 GMT+1