IRESite_Id:69 summary record describing characteristics of gypsy

IRESite: The database of experimentally verified IRES structures

The nucleic acid data:

IRESite Id: `69`	Version: `18`
Originaly submitted by: Petra Sekyrová	Submission date: `2005-10-04 00:00:00`
Reviewed by: Martin Mokrejš	Last change: `2009-03-11 21:43:46`

IRESite record type:

natural_transcript

The shape of the nucleic acid molecule translated: `linear`	The quality of the mRNA/+RNA sequence: `3UTR_incomplete`
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule: `Gypsy`	The genetic origin of this natural mRNA/+RNA: `viral`

The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
2801515

The mRNA/+RNA description:

Drosophila melanogaster gypsy LTR-transposable element, full-lenght RNA (thus missing U3 with possibly part of
R segments on its 5'-end and similarly lack U5 after the transcription termination site on its 3'-end).

The mRNA/+RNA sequence represented in the +DNA notation:

gttcaaatct tgtgtcgaaa taaaccacag cttgctccgg ctcattgccg ttaaacatca ttgttcttat ttacaatcaa atcgctatcg ccacaaggct 
^1         ^11        ^21        ^31        ^41        ^51        ^61        ^71        ^81        ^91        

agtgataata actaaggggg cgaagtcaag ccctccaacc taatctccat aaacagtgtc taagacgaac ctcagcgaaa gaaggaagat ctctagacct 
^101       ^111       ^121       ^131       ^141       ^151       ^161       ^171       ^181       ^191       

actggaaata acataactct ggacctattg gaacttatat aattggcgcc caaccaacaa tctgaaccca ccaatctaat ttaacacact ttgtcaggcg 
^201       ^211       ^221       ^231       ^241       ^251       ^261       ^271       ^281       ^291       

acaaacaggg tagttaagtt agaaaagcat gtaagtttta caagacactt ctttgacgca atcaagaaat ttacgagtga aaaaaaaaaa aaaaaaaagt 
^301       ^311       ^321       ^331       ^341       ^351       ^361       ^371       ^381       ^391       

tgtgtatctg gccacgtaat aagtgtgcgt tgaatttatt cgcaaaaaca ttgcatattt tcggcaaagt aaaattttgt tgcatacctt atcaaaaaat 
^401       ^411       ^421       ^431       ^441       ^451       ^461       ^471       ^481       ^491       

aagtgctgca tactttttag agaaaccaaa taatttttta ttgcataccc gtttttaata aaatacattg cataccctct tttaataaaa aatattgcat 
^501       ^511       ^521       ^531       ^541       ^551       ^561       ^571       ^581       ^591       

actttgacga aacaaatttt cgttgcatac ccaataaaag attattatat tgcatacccg tttttaataa aatacattgc ataccctctt ttaataaaaa 
^601       ^611       ^621       ^631       ^641       ^651       ^661       ^671       ^681       ^691       

atattgcata cgttgacgaa acaaattttc gttgcatacc caataaaaga ttattatatt gcataccttt tcttgccata ccatttagcc gatcaattgt 
^701       ^711       ^721       ^731       ^741       ^751       ^761       ^771       ^781       ^791       

gctcggcaac agtatatttg tggtgtgcca accaacaacc aatgagttgg gcacataact acagaaaggt taaggtcgaa tacgaaagcg aggatagctg 
^801       ^811       ^821       ^831       ^841       ^851       ^861       ^871       ^881       ^891       

ggaggaggag caagtaggcc aagcattagg tcggccgtta gatagtgcca cggtagatat taccatggac cccaatcaga ttcaagctct tatcgacaat 
^901       ^911       ^921       ^931       ^941       ^951       ^961       ^971       ^981       ^991       

gctgtcagac aggcattgtc gcaacagcaa tcccaatttc agacacaact caattcccta gctgcgcggg tacagagttt gcaggtggaa gcaccgcaaa 
^1001      ^1011      ^1021      ^1031      ^1041      ^1051      ^1061      ^1071      ^1081      ^1091      

tcaagattta cgaaaaagtc tctgttaacc ccgatgttag gtgcgacatt ccccttgaca taataaagtc tgtaccagag ttctccggta cccaagacga 
^1101      ^1111      ^1121      ^1131      ^1141      ^1151      ^1161      ^1171      ^1181      ^1191      

gtatgtggcc tggagacaat cggccatata cgcctacgag ctcttcaaac catacaatgg cagcagtgcc cattatcagg ctgttgccat attaaggaat 
^1201      ^1211      ^1221      ^1231      ^1241      ^1251      ^1261      ^1271      ^1281      ^1291      

aaaatccgtg gcgcagccgg ggctttactg gtctcccaca atacggtatt gaacttcgat gctattttgg ccagactaga ctgcacgtac tcggacaaaa 
^1301      ^1311      ^1321      ^1331      ^1341      ^1351      ^1361      ^1371      ^1381      ^1391      

catccttacg cctgttgagg caaggattgg aaatggttag gcaaggagac ctaccactaa tgcaatacta cgatgaagtt gaaaagaagc taacgcttgt 
^1401      ^1411      ^1421      ^1431      ^1441      ^1451      ^1461      ^1471      ^1481      ^1491      

cactaacaaa atcgtaatga cgcatgaaca agagggtgct gacctgctta acgctgaggt cagagccgac gccctgcatg cttttatttc ggggctcaaa 
^1501      ^1511      ^1521      ^1531      ^1541      ^1551      ^1561      ^1571      ^1581      ^1591      

aaggccctca gagctgtggt cttcccggcc caaccaaaag acctgccatc tgcactggct ttagctagag aagcagaggc aagcatagag agaagcatgt 
^1601      ^1611      ^1621      ^1631      ^1641      ^1651      ^1661      ^1671      ^1681      ^1691      

tcgctaactc ctacgccaag gccgtagagg agcgagcgca ttcgggggca aacggcaaga gccgtttcca ggggaagcca aataaagaag aacagggaca 
^1701      ^1711      ^1721      ^1731      ^1741      ^1751      ^1761      ^1771      ^1781      ^1791      

ggacaggaat ccccacttca ccaaacgccc caaaaataac ggacaaacca acaaggacac tcaggcgcaa gcaccccagc caatggaggt cgattcatcc 
^1801      ^1811      ^1821      ^1831      ^1841      ^1851      ^1861      ^1871      ^1881      ^1891      

tccaggttta ggcagcgtac tgaacattat cagaatcatc ctaacgagtc gaacgcgttt aagaggagaa attcctcaga acgctcaaca ggaccgagac 
^1901      ^1911      ^1921      ^1931      ^1941      ^1951      ^1961      ^1971      ^1981      ^1991      

gacaacgtct gaataacgtt gtccaagagg cccctaaaca aaaggacccc aaagaagagt atgaaaaaac agcaaaggct gcagtcgagg aaatcgacag 
^2001      ^2011      ^2021      ^2031      ^2041      ^2051      ^2061      ^2071      ^2081      ^2091      

cgaaaatgag tacgctccca gtgacgactc gttgaatttt ttagggggcg ctcccggttg ccgttcattg aacgacggct ggctgggaga accttaaaga 
^2101      ^2111      ^2121      ^2131      ^2141      ^2151      ^2161      ^2171      ^2181      ^2191      

tgctaatcga taccgacgcg gcaaaaaact acattaggcc cgtaaaggag ctgaaaaatg taatgccggt cgccagccct ttctcggtga gctcaataca 
^2201      ^2211      ^2221      ^2231      ^2241      ^2251      ^2261      ^2271      ^2281      ^2291      

cggctccacc gaaatcaaac acaaatgctt gatgaaagtc ttcaagcaca tctccccatt ttttcttttg gattctctca atgcgttcga cgctatcata 
^2301      ^2311      ^2321      ^2331      ^2341      ^2351      ^2361      ^2371      ^2381      ^2391      

ggcttggacc tgttaacaca ggccggggta aaactcaacc ttgcagagga ctccttagaa taccagggca tcgctgaaaa gcttcattat ttcagctgcc 
^2401      ^2411      ^2421      ^2431      ^2441      ^2451      ^2461      ^2471      ^2481      ^2491      

ccagtgtaaa tttcactgat gtaaacgata ttgttgtacc tgactccgtt aaaaaggagt tcaaggacac aataataagg aggaagaaag ctttctccac 
^2501      ^2511      ^2521      ^2531      ^2541      ^2551      ^2561      ^2571      ^2581      ^2591      

aacaaatgaa gctcttcctt ttaacaccgc tgtcactgcc acaattcgga cagttgacaa tgaaccggtg tactcaagag cgtacccaac tcttatgggt 
^2601      ^2611      ^2621      ^2631      ^2641      ^2651      ^2661      ^2671      ^2681      ^2691      

gtctccgact ttgtgaacaa cgaggtcaaa caactgctga aagacggcat tatcaggccc tcaaggtctc cctataacag cccgacctgg gttgttgaca 
^2701      ^2711      ^2721      ^2731      ^2741      ^2751      ^2761      ^2771      ^2781      ^2791      

aaaaggggac cgacgccttc gggaacccaa acaagaggtt ggtcattgac ttcaggaagc taaatgagaa aactattcct gaccggtacc cgatgcctag 
^2801      ^2811      ^2821      ^2831      ^2841      ^2851      ^2861      ^2871      ^2881      ^2891      

cattcccatg attctagcga atctgggcaa ggcaaagttc ttcactaccc ttgatcttaa gtcagggtat catcaaattt acctcgcgga acacgaccgc 
^2901      ^2911      ^2921      ^2931      ^2941      ^2951      ^2961      ^2971      ^2981      ^2991      

gagaagacat cgttctcggt gaatggtggt aaatacgagt tttgccgtct accgttcggc ttgagaaatg caagcagcat ttttcaaaga gccctagacg 
^3001      ^3011      ^3021      ^3031      ^3041      ^3051      ^3061      ^3071      ^3081      ^3091      

atgtgcttag agagcaaatc gggaagatat gttacgtcta tgtagatgac gtcataattt tctctgaaaa cgagtccgac catgtccgcc acatcgatac 
^3101      ^3111      ^3121      ^3131      ^3141      ^3151      ^3161      ^3171      ^3181      ^3191      

agtactaaaa tgcctgatcg atgccaacat gagagtaagc caggagaaaa ctagattctt taaagagagt gtagaatacc tcggctttat tgtcagtaag 
^3201      ^3211      ^3221      ^3231      ^3241      ^3251      ^3261      ^3271      ^3281      ^3291      

gacggaacta aatccgatcc agagaaggtg aaggccattc aggagtaccc tgaaccagac tgcgtttaca aggttaggtc cttccttggt ttagccagct 
^3301      ^3311      ^3321      ^3331      ^3341      ^3351      ^3361      ^3371      ^3381      ^3391      

actacagagt cttcatcaaa gactttgctg ccatagcccg cccgatcacc gatatcctaa aaggggaaaa tggttcggtg agcaaacaca tgtctaaaaa 
^3401      ^3411      ^3421      ^3431      ^3441      ^3451      ^3461      ^3471      ^3481      ^3491      

aattcctgtt gagtttaatg aaactcaacg caacgcgttc caaagactgc gaaacatact agcatccgag gatgtcatac tcaaataccc cgactttaaa 
^3501      ^3511      ^3521      ^3531      ^3541      ^3551      ^3561      ^3571      ^3581      ^3591      

aagccttttg accttactac agatgcttcg gcaagtggta tcggtgcagt cctatcccag gagggcaggc caatcaccat gatatcgcgt acccttaaac 
^3601      ^3611      ^3621      ^3631      ^3641      ^3651      ^3661      ^3671      ^3681      ^3691      

agcccgagca gaactacgcc acaaacgaaa gggaattgct ggcgattgta tgggccctag gtaagttgca gaacttcctg tatggctcta gggagattaa 
^3701      ^3711      ^3721      ^3731      ^3741      ^3751      ^3761      ^3771      ^3781      ^3791      

tatatttacc gaccatcaac ccctcacttt cgctgttgcc gacaggaaca cgaatgccaa gataaagagg tggaaatctt acatagacca gcataatgcc 
^3801      ^3811      ^3821      ^3831      ^3841      ^3851      ^3861      ^3871      ^3881      ^3891      

aaggttttct acaaacctgg caaagaaaat ttcgtggcag acgccctctc taggcagaat ctgaatgcct tacaaaacga accccaatca gacgctgcga 
^3901      ^3911      ^3921      ^3931      ^3941      ^3951      ^3961      ^3971      ^3981      ^3991      

ccattcacag tgagctctcc ctgacctaca cggtcgagac aacagacaaa ccgttaaatt gcttcaggaa ccagatcatt ctggaggcag cacgttttcc 
^4001      ^4011      ^4021      ^4031      ^4041      ^4051      ^4061      ^4071      ^4081      ^4091      

gctcaaacga aacctggtgc tctttcgaag caaatctcgc cacttaatca gctttactga taaaagttgg ctattaaaaa cacttaagga ggtggtaaac 
^4101      ^4111      ^4121      ^4131      ^4141      ^4151      ^4161      ^4171      ^4181      ^4191      

cctgacgtcg tgaacgctat tcactgcgac ctgcccactc tggcaagctt ccaacacgac ctcattgccc actttccagc cacccaattt cgtcactgta 
^4201      ^4211      ^4221      ^4231      ^4241      ^4251      ^4261      ^4271      ^4281      ^4291      

agaatgtcgt gttagacata accgacaaaa acgaacagat cgaaatcgtc actgccgagc acaaccgcgc tcacagagcc gcacaagaaa acattaaaca 
^4301      ^4311      ^4321      ^4331      ^4341      ^4351      ^4361      ^4371      ^4381      ^4391      

agtccttcgg gattattact ttcccaaaat gggcagttta gctaaagaag tagtagctaa ttgtagggtc tgcacccaag caaagtatga caggcacccg 
^4401      ^4411      ^4421      ^4431      ^4441      ^4451      ^4461      ^4471      ^4481      ^4491      

aaaaagcaag agctcgggga aacgcccata cccagctata caggtgagat ggtgcatatt gacatattct caaccgacag gaagctattc ctgacgtgta 
^4501      ^4511      ^4521      ^4531      ^4541      ^4551      ^4561      ^4571      ^4581      ^4591      

ttgacaaatt ttctaaatat gcaatagtgc aaccagtggt gtctagaaca atagtggaca tcacagcacc cctgttgcag atcattaacc tgttccccaa 
^4601      ^4611      ^4621      ^4631      ^4641      ^4651      ^4661      ^4671      ^4681      ^4691      

tatcaaaacg gtctattgtg acaatgagcc cgcatttaac tcagaaactg tcacctcaat gctcaagaac agcttcggca ttgacatagt aaatgcgccc 
^4701      ^4711      ^4721      ^4731      ^4741      ^4751      ^4761      ^4771      ^4781      ^4791      

ccactccaca gctcatccaa tggccaagtt gaacggttcc acagcacatt ggcagaaatc gccaggtgcc tgaagttgga caaaaaaacg aatgacacag 
^4801      ^4811      ^4821      ^4831      ^4841      ^4851      ^4861      ^4871      ^4881      ^4891      

tagaactaat cttgagggcg acgatagaat ataacaaaac cgtgcactca gttactcgtg agagaccaat tgaggtggtt cacccagggg cccacgagcg 
^4901      ^4911      ^4921      ^4931      ^4941      ^4951      ^4961      ^4971      ^4981      ^4991      

ctgcctagaa atcaaggcaa gattagtaaa ggctcagcaa gacagcatcg gaagaaacaa cccttcccga caaaaccgcg tgtttgaggt gggagaacgc 
^5001      ^5011      ^5021      ^5031      ^5041      ^5051      ^5061      ^5071      ^5081      ^5091      

gtgtttgtaa aaaacaacaa gaggttagga aataagctaa ctccactatg caccgagcaa aaagtgcagg cagacttggg aacgtctgtt cttattaagg 
^5101      ^5111      ^5121      ^5131      ^5141      ^5151      ^5161      ^5171      ^5181      ^5191      

ggagggtggt ccacaaggac aacctcaagt agacattccc tctacagtta ggtagtaagt tatgtcaagg aaaatccgag cactgtagta tcaccttgtc 
^5201      ^5211      ^5221      ^5231      ^5241      ^5251      ^5261      ^5271      ^5281      ^5291      

tttaatttcc aggttcaccc tcatgatgtt catacccttg gtagtagcga atgctcggat caccgacttt tcgcatgcca actacattcc tgtgttagat 
^5301      ^5311      ^5321      ^5331      ^5341      ^5351      ^5361      ^5371      ^5381      ^5391      

ggggatgtgc tggtgtttga acagcgtgac ctcttgaaac attcgagtaa cctttccgag tacgctagta tgatagatga aacacagaaa ctgtccgagt 
^5401      ^5411      ^5421      ^5431      ^5441      ^5451      ^5461      ^5471      ^5481      ^5491      

cctttcccca ctcacatatg cgtaagttgc tagaggtcga tactgaccat cttagaacct tgttgtccgt tctcaaagtc caccatagga tagctaggag 
^5501      ^5511      ^5521      ^5531      ^5541      ^5551      ^5561      ^5571      ^5581      ^5591      

tctagatttc ttaggtacag ccttaaaggt tgtggcgggt actcccgatg ccacggacct ctttaaaatt aagatcacag aggcccaact agtagaatct 
^5601      ^5611      ^5621      ^5631      ^5641      ^5651      ^5661      ^5671      ^5681      ^5691      

aattccaggc agatagctat aaactccgaa acccagaaac agataaataa gttaactgac accatcaata aggtgatcaa tgcccgtaaa ggcgacttgg 
^5701      ^5711      ^5721      ^5731      ^5741      ^5751      ^5761      ^5771      ^5781      ^5791      

ttgacactcc acacttatat gaagcactac tagcaagaaa taggatgctg tctacagaaa ttcaaaattt aattctcact attactttgg tcaaatcaaa 
^5801      ^5811      ^5821      ^5831      ^5841      ^5851      ^5861      ^5871      ^5881      ^5891      

cattataaat cccacaattc ttgatcatgc cgacttgaag cctcttgtag aacaggatac cccaattgtc agcttaatag aagcatctaa gatcagggtc 
^5901      ^5911      ^5921      ^5931      ^5941      ^5951      ^5961      ^5971      ^5981      ^5991      

ctccagtccg agaatagcat tcatatttta attgcctatc ctagagtcaa gttcagttgc aagaaagtcg ccgtctaccc tgtatctcac caacacacca 
^6001      ^6011      ^6021      ^6031      ^6041      ^6051      ^6061      ^6071      ^6081      ^6091      

tcttgcgcct cgacgaagac actttggccg aatgcgaaca tgacaccttt gcggtcaccg gatgcacaga caccacacac ttcacgttct gcgagcggtc 
^6101      ^6111      ^6121      ^6131      ^6141      ^6151      ^6161      ^6171      ^6181      ^6191      

tcggcgcgaa acttgcgtgc gctcactcca tgctggaaac gctgctcaat gccacactca acccagccac ttgcgagaaa taaaccccgt agatgatggc 
^6201      ^6211      ^6221      ^6231      ^6241      ^6251      ^6261      ^6271      ^6281      ^6291      

gttgtgatta tcaacgaagc cgcagctcac gttagcactg atggcagccc cgaaacactg atagagggaa cctacctggt aaccttcgag cgaacggcaa 
^6301      ^6311      ^6321      ^6331      ^6341      ^6351      ^6361      ^6371      ^6381      ^6391      

ccatcaacgg ctctgaattc gtaaatctaa ggaaaacact aagcaagcag ccaggcatcg tgcgttcacc actacttaac atcgtcggcc acgaccctgt 
^6401      ^6411      ^6421      ^6431      ^6441      ^6451      ^6461      ^6471      ^6481      ^6491      

gctcagtata cctctgctac accggatgag taacgaaaac ctacattcca tccaaaacct tatggatgac gtggaatctg aaggctcgcc cagactctgg 
^6501      ^6511      ^6521      ^6531      ^6541      ^6551      ^6561      ^6571      ^6581      ^6591      

ttcgtggctg gtgtggtcct aaacttcggc ttgattggct ctctcgccct ttatctggca ttaaggagaa gacgagcctc tagggagata cagcgcacca 
^6601      ^6611      ^6621      ^6631      ^6641      ^6651      ^6661      ^6671      ^6681      ^6691      

tcgatacttt caacatgacc gaggacggtc ataaacttga ggggggagta gttaacaact aacaatgtat tgcttcgtag caactaagta gctttgtatg 
^6701      ^6711      ^6721      ^6731      ^6741      ^6751      ^6761      ^6771      ^6781      ^6791      

aacaatgctg acgcgccaga attgggttca acgctccacg cgaagaatgc ctggcagcgg aaagctgaca cttcctaccg ggagtgttgc ttcacgctgc 
^6801      ^6811      ^6821      ^6831      ^6841      ^6851      ^6861      ^6871      ^6881      ^6891      

aagaaatgct gagtcggctt gccgacttgt ggcggcgcga tgcattgctc gagggtaaac ttagttttca atattgtctt ctactcagtt caaatcttgt 
^6901      ^6911      ^6921      ^6931      ^6941      ^6951      ^6961      ^6971      ^6981      ^6991      

gtcgaaataa accacagctt gctccggctc attgccgtta aacatcattg ttcttattta caatcaaatc gctatcgcca caaggctagt gataataact 
^7001      ^7011      ^7021      ^7031      ^7041      ^7051      ^7061      ^7071      ^7081      ^7091      

aagggggcga agtcaagccc tccaacctaa tctccataaa cagtgtctaa gacgaacctc agcgaaagaa ggaagatctc tagacctact ggaaataaca 
^7101      ^7111      ^7121      ^7131      ^7141      ^7151      ^7161      ^7171      ^7181      ^7191      

taactctgga cctattggaa cttatataat tagttaacaa ctaacaatgt attgcttcgt agcaactaag tagctttgta tgaacaatgc tgacgcgcca 
^7201      ^7211      ^7221      ^7231      ^7241      ^7251      ^7261      ^7271      ^7281      ^7291      

gaattgggtt caacgctcca cgcgaagaat gcctggcagc ggaaagctga cacttcctac cgggagtgtt gcttcacgct gcaagaaatg ctgagtcggc 
^7301      ^7311      ^7321      ^7331      ^7341      ^7351      ^7361      ^7371      ^7381      ^7391      

ttgccgactt gtggcggcgc gatgcattgc tcgagggtaa acttagtttt caatattgtc ttctactc
^7401      ^7411      ^7421      ^7431      ^7441      ^7451      ^7461

Credibility of mRNA sequence:

guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail

The organism containing this mRNA with IRES segment in its genome:

Drosophila melanogaster

A promoter reported in cDNA corresponding to IRES sequence:
not tested The total number of notable open-reading frames (ORFs):
2

Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:

ORF

ORF position:

1

Version: `7`	Last change: `2006-08-07 00:00:00`
Originaly submitted by: Petra Sekyrová	Reviewed by: Martin Mokrejš

The abbreviated name of this ORF/gene:
gag

The description of the protein encoded in this ORF:
gag

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

842-2197

ORF

ORF position:

2

Version: `1`	Last change: `2006-08-07 00:00:00`
Originaly submitted by: Martin Mokrejš	Reviewed by: Martin Mokrejš

The abbreviated name of this ORF/gene:
gag-pol

The description of the protein encoded in this ORF:
gag-pol protein

The translational frameshift (ribosome slippage) involved:
+2 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

842-5232

Remarks:

The GI:2801515 sequence represents genomic +RNA of the LTR retroelement gypsy. This genomic RNA serves as a
template for gag (843-2198) gag-pol ORF (843-5233) translation of the GI:2801515. During the gag-pol
translation a ribosomal slippage is involved. The gag protein is translated from 843-2198, then the ribosome
slides +2 nt (AG 2199-2200) and continues from ATG 2201.

The gene env is translated with frameshift +1 from subgenomic spliced variant (coding sequence
join(330..331,5314..6763)) of the GI:2801515 (which has complete LTR so it does not correspong the the mRNA
transcript).


From annotation of X78389 it can be deduced the transcription start site should be after
CTTAGTTTTCAATATTGTCTTCTACTC sequence. Thus, the sequence GI:2801515 is a sequence of mRNA transcript with
complete 5'-end and that is why we based on it our annotation.

A list of various gypsy sequences follows:
gi|467632|emb|Z31368.1
gi|157583|gb|M12927.1
gi|340880|gb|M23335.1
gi|535597|gb|M23337.1
gi|2801515|gb|AF033821.1
gi|8036|emb|X03734.1
gi|157580|gb|K01957.1
gi|158636|gb|K03144.1
gi|158633|gb|K03142.1
gi|8212|emb|X00529.1
gi|158635|gb|K03143.1
gi|157850|gb|M54880.1
gi|483721|emb|X78389.1
gi|157579|gb|K01956.1
gi|157584|gb|M63280.1
gi|157573|gb|K01952.1
gi|157576|gb|K01954.1
gi|157574|gb|K01953.1
gi|157577|gb|K01955.1
gi|158617|gb|M38656.1



For more details visit http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=rv.section.8093 and
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=rv.table.7789.


For FlyBase annotation of the various gypsy elements see
http://flybase.bio.indiana.edu/.bin/fbidq.html?FBgn0001167&content=full-report.

Authors obtained 5'UTR sequence by PCR amplification of the complete gypsy clone accession No. flybase:M12927,
which is the same as GenBank accession M12927 alias version number GI:157583. DNA sequence GI:157583 published
on 21-JUL-1995 (size 7469 bp) differs on both ends from GI:2801515 published on 17-FEB-2004 (size 7469 bp).
However, authors refer to AUG330 codon, which is not present in GI:157583 but instead in GI:2801515. Also
protein coding regions are better annotated in GI:2801515, thus, another reason to base our annotation on
this record.

The original paper does not describe the PCR primers used so it is not possible to verify whether one could
obtain GI:2801515 by the same approach. Authors studied these isolated parts of the 5'UTR regions: 1-846 in
plasmid construct pDC-WT, 330-846 in pDC-delta1, 530-846 in pDC-delta2, 664-790 in pDC-delta3, 769-790 in
pDC-delta4, 768-846 in pDC-delta5. Bicistronic mRNA (capped and uncapped) were tested in rabbit reticulocyte
lysates. Human 293T cells expressing polioviral 2A protease were transiently transfected with these plasmids
to produce monocistronic messages.

Citations:

Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515

Gabus C., Ivanyi-Nagy R., Depollier J., Bucheton A., Pelisson A., Darlix J. L. (2006) Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy. Nucleic. Acids. Res. 34(20):5764-5777

IRESs:

IRES:

Version: `8`	Last change: `2008-07-07 08:18:12`
Originaly submitted by: Petra Sekyrová	Reviewed by: Martin Mokrejš
The IRES name: `gypsy_env`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

1-330

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

The sequence of IRES region aligned to its secondary structure (if available):

gttcaaatct tgtgtcgaaa taaaccacag cttgctccgg ctcattgccg ttaaacatca ttgttcttat ttacaatcaa atcgctatcg ccacaaggct 
^1         ^11        ^21        ^31        ^41        ^51        ^61        ^71        ^81        ^91        

agtgataata actaaggggg cgaagtcaag ccctccaacc taatctccat aaacagtgtc taagacgaac ctcagcgaaa gaaggaagat ctctagacct 
^101       ^111       ^121       ^131       ^141       ^151       ^161       ^171       ^181       ^191       

actggaaata acataactct ggacctattg gaacttatat aattggcgcc caaccaacaa tctgaaccca ccaatctaat ttaacacact ttgtcaggcg 
^201       ^211       ^221       ^231       ^241       ^251       ^261       ^271       ^281       ^291       

acaaacaggg tagttaagtt agaaaagcat
^301       ^311       ^321

Citations:

Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515

IRES:

Version: `12`	Last change: `2008-07-07 13:17:37`
Originaly submitted by: Petra Sekyrová	Reviewed by: Martin Mokrejš
The IRES name: `gypsyD5`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

530-790

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

The sequence of IRES region aligned to its secondary structure (if available):

ataatttttt attgcatacc cgtttttaat aaaatacatt gcataccctc ttttaataaa aaatattgca tactttgacg aaacaaattt tcgttgcata 
^530       ^540       ^550       ^560       ^570       ^580       ^590       ^600       ^610       ^620       

cccaataaaa gattattata ttgcataccc gtttttaata aaatacattg cataccctct tttaataaaa aatattgcat acgttgacga aacaaatttt 
^630       ^640       ^650       ^660       ^670       ^680       ^690       ^700       ^710       ^720       

cgttgcatac ccaataaaag attattatat tgcatacctt ttcttgccat accatttagc c
^730       ^740       ^750       ^760       ^770       ^780       ^790

Remarks:

Confirmed only in rabbit reticulocyte lysate translation system; in cell cultures (human 293 T cells,
Drosophila SL2 cells,HeLa cells, CHO cells) was translation insufficient and moreover, segment dmgypsyD1
(330-846) even inhibited the translation.

Citations:

Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515

IRES:

Version: `11`	Last change: `2008-07-07 13:17:37`
Originaly submitted by: Petra Sekyrová	Reviewed by: Martin Mokrejš
The IRES name: `gypsyD2`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

330-846

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

The sequence of IRES region aligned to its secondary structure (if available):

tgtaagtttt acaagacact tctttgacgc aatcaagaaa tttacgagtg aaaaaaaaaa aaaaaaaaag ttgtgtatct ggccacgtaa taagtgtgcg 
^330       ^340       ^350       ^360       ^370       ^380       ^390       ^400       ^410       ^420       

ttgaatttat tcgcaaaaac attgcatatt ttcggcaaag taaaattttg ttgcatacct tatcaaaaaa taagtgctgc atacttttta gagaaaccaa 
^430       ^440       ^450       ^460       ^470       ^480       ^490       ^500       ^510       ^520       

ataatttttt attgcatacc cgtttttaat aaaatacatt gcataccctc ttttaataaa aaatattgca tactttgacg aaacaaattt tcgttgcata 
^530       ^540       ^550       ^560       ^570       ^580       ^590       ^600       ^610       ^620       

cccaataaaa gattattata ttgcataccc gtttttaata aaatacattg cataccctct tttaataaaa aatattgcat acgttgacga aacaaatttt 
^630       ^640       ^650       ^660       ^670       ^680       ^690       ^700       ^710       ^720       

cgttgcatac ccaataaaag attattatat tgcatacctt ttcttgccat accatttagc cgatcaattg tgctcggcaa cagtatattt gtggtgtgcc 
^730       ^740       ^750       ^760       ^770       ^780       ^790       ^800       ^810       ^820       

aaccaacaac caatgag
^830       ^840

Remarks:

The gypsy retroelement seems to contain two IRES sites: dmgypsy_env somewhere in the first 330 nt, dmgypsyD5
within 530-790 nt. The region denoted as dmgypsyD1 in the paper (330-846) harbors RNA sequence which
inhibits translation in human 293T cells and Drosophila SL2 cells.

Citations:

Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515

Last change to the database: 2019-03-18 09:32:49 GMT+1